Functional genomic screening reveals asparagine dependence as a 1 metabolic vulnerability in sarcoma

44 Current therapies for sarcomas are often inadequate. This study sought to 45 identify actionable gene targets by selective targeting of the molecular networks 46 that support sarcoma cell proliferation. Silencing of asparagine synthetase 47 (ASNS), an amidotransferase that converts aspartate into asparagine, produced 48 the strongest inhibitory effect on sarcoma growth in a functional genomic screen 49 of mouse sarcomas generated by oncogenic Kras and disruption of Cdkn2a. 50 ASNS silencing in mouse and human sarcoma cell lines reduced the percentage 51 of S phase cells and impeded new polypeptide synthesis. These effects of ASNS 52 silencing were reversed by exogenous supplementation with asparagine. Also, 53 asparagine depletion via the ASNS inhibitor amino sulfoximine 5 (AS5) or 54 asparaginase inhibited mouse and human sarcoma growth in vitro, and genetic 55 silencing of ASNS in mouse sarcoma cells combined with depletion of plasma 56 asparagine inhibited tumor growth in vivo. Asparagine reliance of sarcoma cells 57 may represent a metabolic vulnerability with potential anti-sarcoma therapeutic 58 value. (152 words) 59 60 61 62 63 64 65 66 67 68 69 Introduction 70 71 Soft-tissue sarcomas (STS) are a heterogeneous group of non-hematopoietic, 72 mesodermal cancers. Certain STS types present with tissue-specific features, 73 such as skeletal muscle differentiation in rhabdomyosarcoma (RMS) (Parham 74 and Barr, 2013). For most STS tumors, cure depends on radical resection and/or 75 radiation of the tumor, and therapeutic options for tumors that have spread 76 regionally and/or systemically are limited (Linch et al., 2014). The genetic 77 spectrum of STS is heterogeneous. Many tumors carry complex karyotypes with 78 variable genetic changes; others express specific oncogenic mutations or 79 exclusive chromosomal translocations within a relatively simple karyotype (Bovee 80 and Hogendoorn, 2010). For RMS, two main genotypes have been described: 81 those characterized by expression of the fusion oncogenes PAX3:FOXO1 or 82 PAX7:FOXO1 and those that lack these fusions. The most common oncogenic 83 mutations in the latter group of fusion-negative RMS tumors are in the Ras 84 pathway (Shern et al., 2014, Chen et al., 2013). 85 We previously reported rapid sarcoma induction by intramuscular implantation 86 of Kras(G12V)-expressing, Cdkn2a (p16p19) deficient mouse myofiber87 associated (MFA) cells into the extremity muscles of NOD.SCID mice (Hettmer et 88 al., 2011). Transcriptional profiling of Kras; p16p19 sarcomas identified a 89 cluster of sarcoma-relevant candidate genes. These genes are enriched in 90 mouse sarcomas and in human RMS as compared to normal mouse or human 91 skeletal muscle (Hettmer et al., 2011), and may include transcripts of 92 fundamental importance for sarcoma growth. To examine the contributions of 93 each of these candidate genes to sarcoma growth, we performed a customized 94 shRNA-based proliferation screen. The strongest inhibitory effect on sarcoma cell 95 proliferation was observed after silencing of asparagine synthetase (ASNS), the 96 enzyme that catalyzes cellular synthesis of the non-essential amino acid 97 asparagine. We found that adequate availability of asparagine is required in 98 rapidly proliferating sarcomas cells, likely to support nascent polypeptide 99 synthesis, and that asparagine starvation impedes sarcoma growth. Thus, small 100 molecules targeting asparagine availability (Richards and Kilberg, 2006) could be 101 useful as anti-sarcoma therapeutics. 102 103 Results 104 105 Kras;p16p19null mouse sarcomas identify a cluster of sarcoma-relevant 106 genes. In prior work, we showed that ex-vivo lentiviral transduction with 107 oncogenic Kras(G12v) of Cdkn2a (p16p19)-deficient myofiber-associated (MFA) 108 cells, isolated by fluorescence activated cell sorting (FACS) from muscle tissue of 109 Cdkn2a mice, drives rapid sarcoma formation upon transplantation of these 110 cells into the muscle of immunocompromised mice (Hettmer et al., 2011) (Figure 111 1 – figure supplement 1). The myogenic differentiation status of the Ras-driven 112 sarcomas generated in this system depends largely on the cell type transduced, 113 also known as the “cell-of-origin”: Kras; p16p19 satellite cells typically gave 114 rise to RMS, whereas the identical oncogenetic lesions introduced into 115 fibroadipogenic precursors within the MFA cell pool almost always produced 116 sarcomas lacking myogenic differentiation features (non-myogenic sarcomas, 117 NMS) (Hettmer et al., 2011) (Figure 1 – figure supplement 1). We previously 118 showed that Kras;p16p19 mouse sarcomas from each of these cellular origins 119 recapitulate transcriptional profiles across the entire spectrum of human RMS 120 and used this information to identify 141 genes of potential significance for 121 sarcoma growth (Hettmer et al., 2011). To evaluate the functional contributions of 122 each of the previously identified sarcoma-relevant genes, we designed a 123 customized shRNA proliferation screen, using 5 distinct shRNAs per candidate 124 gene (Supplementary Files 1-4). The screen was carried out in one 125 Kras;p16p19 RMS and one Kras;p16p19 NMS cell line, and shRNAs were 126 delivered in puromycin-selectable pLKO lentiviral vectors. Correlation coefficients 127 of 0.8348 and 0.9501 between puromycin-treated and untreated cells confirmed 128 adequate transduction efficiencies (Figure 1A, 1F). As shRNA mediated silencing 129 of Kras(G12v)-IRES-GFP, the driver oncogene used to initiate the mouse 130 sarcomas, markedly inhibits the growth of Kras;p16p19 sarcoma cells (Figure 131 2A-B, Figure 2 figure supplement 1A-B), shRNAs directed against either GFP or 132 KRAS served as positive controls in this screen and showed clear growth133 inhibitory effects (Figure 1C-D, 1H-I). Control shRNAs (cntrl-shRNA) directed 134 against LACZ, red fluorescent protein (RFP) and luciferase (LUC) served as 135 negative controls, and showed no growth-inhibitory effects (Figure 1C-D, 1H-I). 136 Receiver operator curve (ROC) analysis, using an external control set of shGFP137 infected and cntrl-shRNA-infected RMS and NMS cells (Supplementary Files 3-4), 138 validated the ability of this system to distinguish between shRNAs with and 139 without growth-inhibitory effects on sarcoma cell proliferation (Figure 1B, 1G). 140 ROC analysis also determined a false discovery rate of <30% for shRNAs 141 associated with a reduction in proliferation to <52% of the average of cntrl142 shRNA-infected RMS cells (Figure 1B-C) and <40% of cntrl-shRNA-infected 143 NMS cells (Figure 1G-H). In both RMS and NMS cells, silencing of ASNS 144 (Asparagine Synthetase) produced by far the strongest anti-proliferative effect 145 (p<0.0001, q<0.01, 4-5 of 5 shRNAs with FDR<30%; Figure 1D, 1I and 146 Supplementary Files 5-6). ASNS silencing reduced the growth of Kras;p16p19 147 RMS and NMS cells to 30.16% and 6.69% of the average of control RMS and 148 NMS cells, respectively. Effective depletion of ASNS protein by the target149 specific shRNAs employed in our screen was confirmed by Western Blot (Figure 150 1E, 1J). 151 152 ASNS silencing inhibits growth of mouse Kras;p16p19null sarcoma cells by 153 asparagine starvation. ASNS encodes the enzyme asparagine synthetase, 154 which converts aspartate into asparagine using glutamine as a nitrogen donor. 155 Therefore, we next tested if the growth-inhibitory effects of genetic ASNS 156 inhibition (Figure 1D, 1I) on mouse sarcoma growth were reversed by exogenous 157 supplementation with the ASNS product asparagine. Supplementation of the 158 culture media with 100mg/L asparagine reversed the growth inhibition observed 159 in shASNS-infected Kras;p16p19 RMS (Figure 2A-2B) and NMS (Figure 2 – 160 figure supplement 1A-1B) cells. Dose response analysis revealed that reversal of 161 growth inhibiton of shASNS-transduced Kras;p16p19null RMS and NMS cells 162 was also observed at 10mg/L asparagine, whereas 0.01, 0.1 or 1mg/L 163 asparagine were insufficient (Figure 2 figure supplement 2). Asparagine 164 supplementation did not reverse the growth inhibitory effect of shRNA-mediated 165 silencing of Kras in Kras;p16p19 RMS cells (Figure 2A-2B). Taken together, 166 we conclude that the growth-inhibitory effects of ASNS silencing on mouse 167 sarcoma cells result from cellular asparagine starvation. 168 169 Asparagine starvation reduces cell proliferation, increases cell death and 170 impedes nascent polypeptide synthesis in mouse Kras;p16p19null sarcoma 171 cells. Asns silencing in mouse Kras;p16p19 RMS cells caused an increase in 172 the fraction of sarcoma cells undergoing apoptosis, as determined by staining 173 with propidium iodide (PI) and Annexin V (p<0.001, Figure 2C-2D). Moreover, 174 Asns silencing reduced the percentage of BrdU+ cells in S phase (p<0.001, 175 Figure 2E-2F). Both effects were reversed by exogenous asparagine 176 supplementation (Figure 2D, 2F). To evaluate whether cellular asparagine 177 starvation due to Asns silencing impedes sarcoma cell proliferation by interfering 178 with the cells’ ability to generate nascent polypeptide chains, Kras;p16p19 179 RMS cells were exposed to O-propargyl-puromycin (OP-puromycin). OP180 puromycin forms covalent conjugates with newly synthesized polypeptides, which 181 can be visualized by azide-alkyne cycloaddition. Rapidly proliferating shLUC182 infected Kras;p16p19 RMS cells exhibited strong OP-puromycin staining, 183 indicating brisk polypeptide synthesis (Figure 2G, middle panels). However, 184 blockade of protein translation by exposure to cycloheximide abrogated OP185 puromycin staining (Figure 2G, far right panels). Similarly, shASNS-infected cells 186 exhibited only minimal OP-puromycin staining (Figure 2G, upper left panel), while 187 synthesis of new polypeptides was restored in shASNS-infected sarcoma cells 188 grown in medium supplemented with asparagine (Figure 2G, lower left panel). 189 Similar effects of ASNS silencing on apoptosis, cell cycle and synthesis of 190 nascent peptide chains were observed in Kras;p16p19 NMS cells (Figure 2 – 191 figure supplement 1). 192 193 Asparagine starvation impedes human RMS growth and polypeptide 194 synthesis. ASNS expression was evaluated in primary human sarcoma tissue 195 by immunohistochemistry (IHC) using a commercially available tissue array (US 196 Biomax SO2081). ASNS was detected in 16 of 22 (73%) human RMS cores 197 (Figure 4 – figure supplement 1A) and in 12 of 27 (44%) human leiomyosarcoma 198 cores (Figure 4 – figure supplement 1B). Also, increased expression of ASNS 199 compared to normal human muscle was detected in 9 of 9 human sarcoma cell 200 lines analyzed by PCR (Figure 4 – figure supplement 1C), including the 201 PAX3:FOXO1-positive human RMS cell line Rh30. To evaluate the impact of 202 ASNS silencing on human RMS cells, we transduced Rh30 cells with lentiviruses 203 encoding shASNS or control (shLACZ) shRNAs (Figure 3). ShRNA-mediated 204 knockdown of ASNS in Rh30 cells (Figure 3A) reduced proliferation (p<0.001; 205 Figure 3B-3C), increased the percentage of apoptotic cells (p<0.01; Figure 3D206 3E), reduced the percentage of cells in S phase (p<0.001; Figure 3F-3G) and 207 impeded nascent polypeptide synthesis (Figure 3H). The effects of ASNS 208 silencing on Rh30 growth and peptide synthesis were reversed by asparagine 209 supplementation (Figure 3B-3H). Thus, ASNS silencing in human Rh30 cells 210 recapitulated the inhibitory effects on cell growth and polypeptide synthesis 211 observed in mouse Kras;p16p19 sarcoma cells. 212 213 Chemical targeting of Asparagine availability reduces sarcoma growth. 214 Asparagine homeostasis represents an actionable cellular process. Amino 215 sulfoximines directly inhibit ASNS activity (Ikeuchi et al., 2012, Richards and 216 Kilberg, 2006), whereas asparaginase, an FDA-approved drug widely used in the 217 treatment of leukemia, hydrolyzes asparagine to aspartate and ammonia. Both 218 amino sulfoximine 5 (AS5) and asparaginase reduced the proliferation of mouse 219 and human sarcoma cell lines in vitro (Figure 4A-4C). For asparaginase, EC50 220 concentrations were estimated at 0.2-0.5 IU/ml in mouse Kras;p16p19 221 sarcoma cells, 0.8-0.9 IU/ml in human HT1080, Rh30 and Rh41 cells and 6 IU/ml 222 in human RD cells (Figure 4A-4B). For the ASNS inhibitor AS5, EC50 223 concentrations were estimated at 80-150 μM in mouse Kras;p16p19 sarcoma 224 cells and 200-300 μM in the human sarcoma cell lines tested (Figure 4A, 4C). 225 Similar to previous observations in cells that underwent genetic inhibition of 226 ASNS, the growth-inhibitory effects of chemical ASNS inhibition by AS5 were 227 reversed by exogenous asparagine supplementation (Figure 4D). These findings 228 strongly suggest that the growth inhibitory effects of AS5 result from asparagine 229 deprivation of sarcoma cells. 230 231 Asparagine depletion impedes mouse sarcoma growth in vivo. Due to the 232 poor cell permeability of AS5, its growth-inhibitory effects on sarcoma cells 233 required EC50 concentrations greater than 80 μM, making in vivo testing 234 infeasible. Thus, to determine the effects of reduced ASNS activity on sarcoma 235 growth in vivo, 100 shASNS-infected and 100 shLUC-infected Kras; p16p19 236 RMS cells were implanted into the cardiotoxin-preinjured gastrocnemius muscles 237 of 1to 3-months old NOD.SCID mice (Figure 5). IHC showed that tumors arising 238 from shASNS cells expressed less ASNS than tumors arising from shLUC cells 239 (Figure 5A). However, there was no difference in latency of shASNSand 240 shLUC-tumors (p=0.3; Figure 5B). 241 Our in vitro data suggested that growth inhibition by induced by ASNS 242 silencing can be rescued by provision of exogenous aparagine at 243 concentrations between 1 and 10 mg/L (Figure 2 figure supplement 2). As 244 normal asparagine concentrations in mouse and human plasma were 245 previously reported to be between 3.8mg/L and 7.3mg/L (Cooney et al., 246 1970), these data suggest that freely available asparagine in mouse serum and 247 tissue might counteract the effects of tumor-specific ASNS silencing. To examine 248 this possibility, we treated subgroups of animals transplanted with shASNSor 249 shLUC-tumor cells with asparaginase (1500IU/kg; (Szymanska et al., 2012)) by 250 daily intraperitoneal (IP) injection. Asparaginase treatment was initiated on the 251 day of tumor cell injection and continued for 35-41 days. This dosage was well 252 tolerated by the animals without significant weight loss (Figure 5C). Serum 253 asparagine levels were reduced 13-fold in asparaginase-treated mice (0.53 mg/L 254 (4μM) versus 6.87 mg/L (52 μM) in untreated mice, p<0.001; Figure 5D and 255 Supplementary File 7). Daily exposure to asparaginase did not change the 256 latency of shLUC-tumors (p=0.5; Figure 5B); however, asparaginase treatment 257 significantly prolonged tumor latency in mice implanted with shASNS-RMS cells 258 (p<0.001; Figure 6B). Moreover, 2 out of 8 mice in this experimental group did 259 not develop tumors during 4 months of follow up after tumor cell injection. Similar 260 effects were observed when NOD.SCID mice were transplanted with shASNS261 infected and shLUC-infected Kras; p16p19 NMS cells (Figure 5 – figure 262 supplement 1). Thus, ASNS inhibition combined with depletion of plasma 263 asparagine reduces sarcoma growth in vivo. 264 265 Discussion 266 Cancer cells depend on biological mechanisms that guarantee adequate 267 provision of energy and biosynthetic precursors to support cell growth. Functional 268 genomic screening of genetically engineered mouse sarcomas revealed that 269 asparagine synthetase (ASNS) exerted the strongest observed effect on 270 sarcoma cell proliferation within a small group of genes upregulated in both 271 mouse and human sarcomas. ASNS is the amidotransferase that converts L272 aspartic acid into L-asparagine in an energy-consuming enzymatic reaction 273 requiring ATP and a nitrogen source that is L-glutamine in eukaryotic cells 274 (Richards and Kilberg, 2006). Depletion of functional ASNS in both mouse and 275 human RMS cells reduced the proportion of cells in S phase and impeded 276 synthesis of nascent polypetide chains. Similarly, ASNS silencing in melanoma 277 cells was recently reported to result in cell cycle arrest (Li et al., 2015). The 278 effects of ASNS reduction in sarcoma cells were reversed by exogenous 279 supplementation with asparagine, supporting the notion that rapidly growing 280 sarcoma cells depend on adequate availability of intrinsic or extrinsic asparagine 281 to support tumor growth. Moreover, ASNS inhibition significantly slowed 282 mouse sarcoma growth in vivo only when combined with depletion of 283 plasma asparagine, likely reflecting the ability of systemic asparagine in 284 the tumor environment to replenish intracellular asparagine availability 285 after ASNS inhibition. We speculate that asparagine reliance of sarcoma cells 286 represents a metabolic vulnerability that could be exploited therapeutically to 287 inhibit rapid tumor growth. 288 Previously published metabolic profiling studies have identified a number of 289 metabolites that are heavily consumed by cancer cell lines, including glycine and 290 asparagine (Jain et al., 2012). Glycine starvation prolonged the G1 phase of the 291 cell cycle and reduced proliferation, in part because sufficient amounts of this 292 amino acid are required to support de novo purine biosynthesis in rapidly dividing 293 cells. Unlike purine synthesis, protein synthesis in glycine-starved cells remained 294 relatively intact (Jain et al., 2012). In contrast, we found that asparagine 295 starvation of mouse and human sarcoma cells impedes synthesis of nascent 296 polypeptide chains thereby slowing cell proliferation. These results are consistent 297 with observations in soybean, barley and maize where free asparagine levels in 298 developing seeds correlate positively with higher protein levels at maturity 299 (Pandurangan et al., 2012). Moreover, limiting the extracellular supply or blocking 300 the synthesis of single amino acids is known to suppress global translation 301 initiation via activation of GCN2 and phosphorylation of the translation initiation 302 factor EIF2α (Sood et al., 2000). Thus, asparagine in the tumor cell environment 303 may have important functions in controlling the synthesis and turnover of protein 304 in sarcoma cells. 305 Impaired peptide biosynthesis may not be the only mechanism 306 contributing to the asparagine dependence of sarcoma cells described in 307 this study. For instance, our data do not exclude the possibility that 308 glutamate deprivation and/or aspartate excess resulting from changes in 309 asparagine biosynthesis negatively impact cell survival and proliferation. 310 However, aspartate carries reducing equivalents in the malate-aspartate 311 shuttle (Son et al., 2013), and so increased aspartate levels after ASNS 312 knockdown might be predicted to benefit the redox state of sarcoma cells. 313 In addition, it has been suggested that increased glutaminase expression 314 in cancer cells can counterbalance decreased glutamate levels, especially 315 in a glutamine-rich environment (Huang et al., 2014). Consistent with this 316 notion, we found that glutaminase expression was increased by 7to 11317 fold in mouse sarcoma cells compared to normal mouse muscle (Figure 2 – 318 figure supplement 3), suggesting that this mechanism may be used by 319 sarcoma cells to counteract glutamate reductions that may result from 320 ASNS silencing. 321 Finally, a recent report demonstrated, unexpectedly, that asparagine 322 supplementation can suppress cell death in glutamine-deprived cells 323 (Zhang et al., 2014), implicating asparagine in promoting cellular adaptation 324 to metabolic stresses such as glutamine depletion. This study also noted 325 that asparagine is the last amino acid synthesized in the TCA cycle and 326 that its amination depends exclusively on glutamine (Zhang et al., 2014). 327 Amino acid availability is known to stimulate mechanistic target of 328 rapamycin (mTOR) complex 1, which integrates environmental and 329 intracellular signals to regulate cell growth (Jewell et al., 2015). Taken 330 together, these observations suggest that asparagine may serve a central 331 role as a cellular sensor of TCA cycle intermediate/ reduced nitrogen 332 availability and, ultimately, as a metabolic regulator of cell behavior. 333 While our studies demonstrate a clear dependence of sarcoma cell 334 growth and survival on cellular asparagine levels, they certainly do not 335 exclude the possibility that adequate availability of amino acids other than 336 asparagine may also be important. The shRNA proliferation screen we 337 performed was designed to evaluate the functional contributions of a 338 particular group of sarcoma signature genes identified by their high level 339 expression in both Ras-driven mouse sarcomas and human sarcomas, and 340 thus did not comprehensively evaluate all amino acid biosynthetic 341 pathways. Indeed, within the cluster of sarcoma genes evaluated, the top342 scoring cellular functions were cell cycle control and cell division (Hettmer 343 et al., 2011). However, we note that in addition to ASNS, our list of 344 candidate targets included genes encoding 3 other enzymes relevant for 345 amino acid biosynthesis: branched chain aminotransferase 1 (BCAT1), 346 phosphoserine aminotransferase (PSAT1) and phosphoglycerate 347 dehydrogenase (PHGDH). Both PHGDH and PSAT1 contribute to serine/ 348 glycine biosynthesis, which plays an important role in supporting 349 nucleotide synthesis in rapidly proliferating cells (Jain et al., 2012, 350 Labuschagne et al., 2014), and recent publications indicate that high 351 expression of PHGDH in tumor tissue is required for cell growth in 352 epithelial malignancies (Locasale et al., 2011, Possemato et al., 2011). 353 However, in our screen, silencing of PSAT1, PHGDH or BCAT1 did not 354 inhibit sarcoma cell growth (Supplementary Files 5-6), suggesting that 355 these biosynthetic pathways may be of lesser importance for the 356 sarcomatous malignancies studied here. 357 ASNS expression among tissues in adult animals varies considerably 358 (Balasubramanian et al., 2013). ASNS in tumor tissue has been linked to the 359 transactivating effects of oncogenic effectors such as TP53 (Scian et al., 2004) 360 and metabolic stress (Balasubramanian et al., 2013, Cui et al., 2007). For 361 example, in pancreatic cancer, glucose deprivation upregulated ASNS 362 expression, which, in turn, protected tumor cells from apoptosis induced by 363 glucose deprivation itself (Cui et al., 2007). Similarly, upregulation of ASNS in 364 response to amino acid restriction, such as plasma asparagine depletion by 365 treatment with asparaginase (Cui et al., 2007), is part of a normal physiological 366 adaptation response to counteract nutrient deprivation (Balasubramanian et al., 367 2013). As sarcomas outgrow the existing vasculature, tumor cells are 368 continuously exposed to a microenvironment in which the supply of nutrients is 369 limited. Thus, increased Asns mRNA expression in Kras;p16p19 mouse 370 sarcomas as compared to normal muscle could occur in response to amino acid 371 and glucose deprivation in rapidly growing sarcomas. 372 Cellular asparagine reliance has been exploited successfully in the treatment 373 of acute lymphoblastic leukemia (ALL) with bacterially derived asparaginase 374 (Haskell et al., 1969, Jaffe et al., 1971, Richards and Kilberg, 2006). 375 Lymphoblasts are thought to be exquisitely sensitive to asparaginase treatment 376 due to their low ASNS expression (Richards and Kilberg, 2006). Growth inhibitory 377 effects of asparaginase on sarcoma cells in vitro were previously reported by 378 Tardito et al (Tardito et al., 2006). However, the response of sarcoma cells to 379 asparaginase alone is moderate to poor (Figure 4A, (Tardito et al., 2006)) when 380 compared to the published spectrum of asparaginase sensitivity of primary 381 lymphoblasts (EC50 concentrations between <0.002 and >10 IU/ml; (Fine et al., 382 2005)). One published report on the efficacy of asparaginase as a single agent 383 documented remissions in 7 of 32 children with ALL, but there was no objective 384 response in a single patient with RMS (Jaffe et al., 1971). Yet, asparaginase is a 385 well-characterized drug with a relatively favorable toxicity profile that does not 386 overlap with the toxicities of conventional cytostatics used in RMS treatment 387 (Haskell et al., 1969), and the further development of specific, cell-permeable 388 chemical inhibitors of ASNS may open additional therapeutic opportunities 389 (Richards and Kilberg, 2006), especially when combined with systemic 390 asparagine depletion. 391 Understanding the molecular networks that support sarcoma cell proliferation 392 may enable the development of therapies based on selective targeting of 393 proliferation-relevant cellular pathways. This study identified asparagine 394 starvation as a candidate intervention that impedes sarcoma growth. Yet, it is 395 highly unlikely that any interventions will have noticeable anti-sarcoma effects in 396 vivo when used alone. For future studies and clinical development, it will be 397 important to rationally select combinations of interventions that target multiple 398 proliferation-relevant cellular processes including Asparagine reliance of sarcoma 399 cells. 400 401 Materials and Methods 402 403 Kras;p16p19null mouse sarcomas. Primary Kras;p16p19null mouse 404 sarcomas were induced by ex-vivo transduction of freshly sorted Cdkn2a-/405 (p16p19null) mouse skeletal muscle precursor cells (CD45-CD11b-TER119406 Sca1-CXCR4+β1integrin+) or Sca1+ fibroadipogenic precursor cells CD45407 CD11b-TER119-Sca1+) with pGIPZ-Kras(G12V)-IRES-GFP lentivirus followed 408 by intramuscular transplantation of Kras-expressing, p16p19null cells into 409 the cardiotoxin-preinjured gastrocnemius muscles of 1to 3-months old 410 NOD/SCID mice, as previously described (Hettmer et al., 2011). Secondary 411 Kras;p16p19null mouse sarcomas were generated by implanting 100 412 Kras;p16p19null mouse RMS or NMS cells into the cardiotoxin-preinjured 413 gastrocnemius muscles of 1to 3-months old NOD/SCID mice. 414 415 Human Skeletal Muscle. Use of human muscle was approved by the 416 Institutional Review Board at Joslin Diabetes Center. Human fetal muscle was 417 obtained from 20-23 week gestation fetuses and adult muscle from deceased 418 volunteers. Tissue was homogenized in TRIzol using a tissue homogenizer prior 419 to RNA isolation. 420 421 Mice. C57BL6, NOD/CB17-Prkdcscid/J (NOD/SCID) and p16p19 mice 422 (B6.129 background) mice were obtained from Jackson Laboratory and the 423 National Institutes of Health/Mouse Models of Human Cancer Consortium, 424 respectively. Mice were bred and maintained at the Joslin Diabetes Center 425 Animal Facility. All animal experiments were approved by the Joslin Diabetes 426 Center Institutional Animal Care and Use Committee. 427 428 Sarcoma cell lines. Mouse sarcoma cell lines were established from 2 429 Kras;p16p19 mouse RMS tumors (T14-R, SMP-01) and one Kras;p16p19 430 mouse NMS tumor (Sca1-01). The human RMS cell line RD (translocation431 negative) and the human fibrosarcoma line HT1080 were purchased from ATCC. 432 Human RMS cell lines Rh3, Rh5, Rh10, Rh28, Rh30, Rh41 (all PAX3:FOXO1433 positive) and Rh36 (translocation-negative) were gifts from Dr. Peter Houghton 434 (Nationwide Children’s Hospital, Columbus, OH). All cell lines were maintained in 435 DMEM supplemented with 10% FBS and 1% Penicillin-Streptomycin. To 436 evaluate the effects of asparagine supplementation on sarcoma cells in vitro, 437 4.15g DMEM (D5030, Sigma), 2.25g Glucose, 1.85g NaHCO, 292mg Glutamine, 438 10% FBS and 1% Penicillin Streptomycin were reconstituted in 500ml dH2O and 439 supplemented with or without Asparagine at a concentration of 0 to 100mg/L 440 (A4159, Sigma). 441 442 Customized shRNA proliferation screen. The screen was performed using 443 the Kras;p16p19 RMS line T14R and the Kras;p16p19 NMS line Sca1-01. 444 Cells were plated in DMEM supplemented with 10% FBS and 1% Penicillin445 Streptomycin on day -1 and infected with lentiviruses in the presence of 8μg/ml 446 Polybrene on day 0. Infected cells were selected by adding Puromycin to a final 447 concentration of 2μg/ml on day +1. Cell growth was evaluated by CellTiter Glo on 448 day 8. RMS cells were plated at 900 cells per well and infected with 6μl virus in 3 449 replicates exposed to Puromycin and 2 replicates maintained without Puromycin. 450 NMS cells were plated at 450 cells per well and infected with 4μl virus in 2 451 replicates exposed to Puromycin and 2 replicates maintained without Puromycin. 452 For each cell line, raw data obtained from cells exposed to Puromycin (+ 453 Puromycin, y axis) were plotted against raw data from cells grown without 454 Puromycin (Puromycin, x-axis; figure 1B, 1G). Raw data obtained from cells 455 exposed to PGW or medium only were excluded from the analysis. Standard 456 deviations (SD) from the mean were calculated for each data point, and those 457 with SDs above the upper adjacent limit also were excluded from further analysis. 458 Correlation coefficients between + Puromycin and Puromycin data were 0.8348 459 (RMS) and 0.9501 (NMS), thereby confirming adequate transduction efficiency. 460 For each shRNA, replicate data were pooled and relative cell growth was 461 quantified as the percentage proliferation of shRNA infected cells compared to 462 the mean proliferation of cells infected with cntrl-shRNAs on the same plate. 463 Receiver operator curve analysis using CTR01 data confirmed the ability of the 464 screen to distinguish between the growth-inhibitory effects of shGFP and the 465 neutral effects of cntrl-shRNAs (Figure 1C,H). For RMS and NMS, relative growth 466 of less than 52% or less than 40% of cells infected with cntrl-shRNAs (light gray 467 line in Figure 1D,E, and I,J), respectively, was associated with a false discovery 468 rate less than 30%. Growth differences between cells subjected to silencing of 469 one specific candidate gene and cntrl-shRNA-infected cells were tested for 470 statistical significance using T-tests. Q-values were estimated using the algorithm 471 published by J.W. McNicol and G. Hogan (McNicol, 2013). The growth-inhibitory 472 effects of shRNA-mediated silencing of individual candidate genes were 473 considered significant if p<0.0001 and q<0.01 and 3 shRNAs scored with an 474 FDR<30%. 475 Candidate gene contributions to Kras;p16p19 sarcoma growth were tested 476 using a customized, in vitro shRNA proliferation screen designed using shRNAs 477 from The RNAi Consortium (TRC) delivered in puromycin-selectable pLKO 478 lentiviral vectors. The screen was performed in ten 96-well-plates (DAS36479 DAS45, Supplementary Files 3-4) using one shRNA per well. Five discrete 480 shRNAs were used for each of the 141 candidate genes. The screen also 481 included 3 shRNAs directed against KRAS (shKRAS; positive control) and 482 control shRNAs directed against RFP, LUC or LACZ (cntrl; negative control). 483 Additionally, two 96-well-plates (CTR01, Supplementary Files 5-6) were infected 484 with shRNAs directed against GFP (shGFP; silencing KRAS-IRES-GFP and 485 thereby serving as a positive control) and control shRNAs directed against RFP, 486 LUC and LACZ. Empty pLKO lentiviral vectors (designated PGW; did not contain 487 shRNAs) and medium (medium; did not contain any virus) served as transduction 488 and puromycin controls, respectively. TRC clone IDs and viral titers are listed in 489 Supplementary Files 1-4. The screen was performed using the Kras;p16p19 490 RMS line T14R and the Kras;p16p19 NMS line Sca1-01. 491 492 Immunohistochemistry, Primary human sarcoma tissue was evaluated 493 using commercially available sarcoma tissue arrays (US Biomax SO2081). 494 Human sarcoma sections were stained for ASNS (1 in 100, HPA029318, Sigma; 495 human brain served as positive and muscle as negative control tissue). Mouse 496 tumors were stained for ASNS (1 in 200, HPA029318, Sigma). Antigen retrieval 497 was performed in 10mM sodium citrate buffer pH6, and tissue sections were 498 blocked in PBS, 5% BSA, pH7.4. 499 500 RNA isolation and qRT-PCR. RNA was isolated from fetal and adult whole 501 skeletal muscle, human RD, HT1080, Rh3, Rh5, Rh10, Rh28, Rh30, Rh41 and 502 Rh36 cells by TRIzol extraction followed by DNAse digestion and purification 503 using the RNeasy Plus Micro Kit. RNA was reverse transcribed using Superscript 504 III First-Strand Synthesis System for RT-PCR (Invitrogen). qRT-PCR was 505 performed using an ABI 7900 RT-PCR system (Applied Biosystem) with SYBR506 green PCR reagents. Human ASNS and mouse Gls detected using the following 507 primer sequences: GGAAGACAGCCCCGATTTACT (ASNS, fw), 508 AGCACGAACTGTTGTAATGTCA (ASNS, rev), TTCGCCCTCGGAGATCCTAC 509 (Gls, fw), CCAAGCTAGGTAACAGACCCT (Gls, rev). 510 511 Western blot. Cells were lysed for 10 min on ice in 50 mM HEPES (4-(2512 hydroxyethyl)-1-piperazineethanesulfonic acid), pH7.4, 40 mM NaCl, 2 mM 513 EDTA, 10mM sodium pyrophosphate, 10mM sodium beta-glycerophosphate, 1% 514 Triton X containing complete mini protease inhibitor cocktail (Roche), 50mM NaF 515 and 1 mM sodium orthovanadate. Equal amounts of extract were processed for 516 Western blot using rabbit polyclonal anti-ASNS antibody (1 in 250, HPA029318, 517 Sigma). ASNS protein expression was evaluated using rabbit polyclonal anti518 ASNS antibody (1 in 250, HPA029318, Sigma). Immune complexes were 519 detected by chemiluminescence (ECL, 32132, Pierce). 520 521 Proliferation assays. Sarcoma cells were exposed to asparaginase (0.1522 10IU/ml, stock 5 IU/ml in 0.9% NaCl, MyBioSource) and AS5 (50-500mM, stock 523 10mM in 0.9% NaCl, synthesized by Nigel G Richards). Proliferation assays were 524 performed as previously described (Hettmer et al., 2011). Cells were plated at 525 1000-7000 cells per well on day -1 and exposed to chemicals or vehicle on days 526 0 and 2. Cell growth was determined by MTT assay (Cayman Chemicals) on day 527 4 and quantified as fold-increase in MTT uptake compared with baseline. All 528 assays were performed in triplicate and replicated in two to four independent 529 experiments. Estimated EC50 concentrations were calculated using GraphPad 530 Prism. 531 532 ASNS silencing. ASNS expression was silenced using TRC shRNAs 533 delivered in pLKO vectors. TRC clones TRCN0000324779, TRCN0000031703 534 and TRCN0000031702 were used to silence mouse Asns. TRC clones 535 TRCN0000045875 and TRCN0000045877 were used to silence human ASNS. 536 TRC clones TRCN0000033260 and TRCN0000033262 were used to silence 537 Kras in mouse sarcoma lines. Control cells were infected with lentiviruses 538 carrying TRCN0000072250 (shLUC) and TRCN0000072250 (shLUC) or 539 TRCN0000072231 (shLACZ) and TRCN0000072240 (shLACZ) to control for off540 target effects. 541 Mouse Kras;p16p19 RMS and NMS cells were plated at 1000 cells per well 542 on day -1, infected with lentiviruses in the presence of 8μg/ml polybrene on day 0 543 and selected with puromycin at a final concentration of 2μg/ml starting day 1. 544 Effects of ASNS silencing were evaluated on days 3-5. Human Rh30 cells were 545 plated at 5000 cells per well on day -1, infected with lentiviruses in the presence 546 of 8μg/ml polybrene on day 0 and selected with puromycin at a final 547 concentration of 0.5μg/ml starting day 1. Transduced Rh30 cells were passaged 548 and re-plated at 5000 cells per well. Effects of ASNS silencing were evaluated 3549 5 days after replating. 550 551 Annexin V staining. Annexin V staining was performed according to the 552 manufacturer’s instructions using Annexin V-APC (550474, BD Biosciences) and 553 PI. 554 555 BrdU assay. Cells were incubated with 10mM BrdU (552598, BD) for one 556 hour at 37C. The BD Pharmingen BrdU flow kit (552598, BD) was used to fix 557 and permeabilize cells prior to DNAse treatment and staining with anti-BrdU-APC 558 (1 in 20, 17-5071-42, eBioscience) and Dapi (1 in 1000). 559 560 OP-puromycin staining. OP-puromycin (Medchem Source) was 561 reconstituted in PBS pH6.4 and stored at minus 20 degrees centigrade. Cells 562 were incubated with 50μM OP-puromycin for 1 hour at 37 degrees centigrade, 563 fixed and stained with Alexa Fluor 555-Azide (Life Technologies) as previously 564 described (Liu et al., 2012). Control cells were treated with 50μg/ml 565 cycloheximide for 15 minutes immediately prior to OP-puromycin exposure. 566 Alexa Fluor 555 labeling was analyzed using an Olympus IX51 microscope at 567 20X. 568 569 In vivo asparaginase treatment. Asparaginase was reconstituted in 0.9% 570 normal saline (NS) and stored at 4oC up to 3 weeks. Mice were treated daily 571 with Asparaginase (Elspar, Lundbeck Inc) by intraperitoneal injection at 572 1500IU/kg (Szymanska et al., 2012). 573 574 Serum amino acid levels. Amino acid levels in mouse serum were 575 determined by HPLC. 576 577 Statistics. Please see Supplemental Experimental Procedures for detailed 578 information regarding the statistical analysis of the PCR array and shRNA screen. 579 Differences in cell growth, tumor growth, Annexin staining, BrdU staining and 580 serum amino acid levels were tested for statistical significance using T-tests. 581 Differences in tumor latency were evaluated by logrank (Mantel-Cox) test 582 (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001). 583 584 Acknowledgements 585 We thank Francesca Izzo and Amy Schlauch in the DFCI RNAi Facility for 586 technical assistance with the shRNA screen, Daniel Sherley and the DFCI 587 pharmacy for providing pharmacy-grade Asparaginase (Elspar), Mark Kellogg at 588 Boston Children’s Hospital for mouse serum amino acid analysis and Joyce 589 LaVecchio, Girijesh Burizula and Atsuya Wakayabashe in the Joslin Diabetes 590 Center Flow Cytometry Core (supported by the Harvard Stem Cell Institute and 591 NIH P30DK036836) for flow cytometry support. We are grateful to Tata 592 Nageswara Rao, Richard Lock, Sean Morrison and Leonard Wexler for helpful 593 discussions, and to Jun Hiratake and Hideyuki Ikeuchi for their contributions to 594 the development of AS5. This work was funded in part by a Stand Up To Cancer595 American Association for Cancer Research Innovative Research Grant (SU2C596 AACR-IRG1111; to AJW), NIH grants P01 CA050661, P01 CA142536, U01 597 CA176058 (to WCH) and by a SARC-SPORE career development award and 598 P.A.L.S. Bermuda/St. Baldrick’s (to SH). The authors declare no competing 599 financial interests. Content is solely the responsibility of the authors and does not 600 necessarily represent the official views of the NIH or other funding agencies. 601 602 Figure Legends 603 604 Figure 1. Functional genomic screening identified asparagine 605 synthetase (ASNS) as a high-priority sarcoma target. 141 sarcoma-relevant 606 genes were identified by prior transcriptional profiling of genetically engineered 607 Kras;p16p19 mouse rhabdomyosarcomas (RMS) and non-myogenic sarcomas 608 (NMS) (Hettmer et al., 2011). (A-D, F-I) The contributions of each of the 141 609 sarcoma-relevant genes to sarcoma cell proliferation were determined by 610 customized shRNA screening. (B-D, G-I). The screen contained a control set, 611 including cells exposed to shLUC, shRFP, shLACZ (cntrl; predicted to have no 612 effect on cell proliferation) and cells exposed to shGFP (GFP; predicted to 613 silence Kras(G12V)-IRES-GFP and reduce cell proliferation). (B, G) Receiver 614 operator curve analysis using cntrl-shRNA-infected cells as negative and shGFP615 infected cells as positive controls determined a false discovery rate of <30% for 616 shRNAs associated with a reduction in proliferation to <52% of the average of 617 cntrl-shRNA-infected RMS cells (grey line in panel C) and to <40% of cntrl618 shRNA-infected NMS cells (grey line in panel H). (D, I) The shRNA screen 619 included cells exposed to shLUC, shRFP, shLACZ (cntrl), shKRAS and shRNAs 620 directed against each of the 141 candidate genes (5 shRNAs per gene). ShRNAs 621 directed against the gene encoding Asparagine Synthetase (Asns) showed the 622 strongest effect on NMS and RMS proliferation (p<0.0001, q<0.01, 4-5 of 5 623 shRNAs with FDR<30%). (E-J) Effective ASNS knockdown by the shRNAs used 624 in the screen was confirmed by Western blot. See Supplementary Files 1-4 for 625 raw data from the shRNA screen, and Supplementary Files 5-6 for scores for 626 each of the 141 candidate genes. Significance levels were defined as follows: 1, 627 5 shRNAs with FDR<30%; 2, 4 shRNAs with FDR<30%; 3, 3 shRNAs with 628 FDR<30%. 629 630 Figure 2. Reduced growth of mouse Kras;p16p19null RMS cells after 631 Asns silencing is associated with inhibition of polypeptide synthesis. (A-B) 632 ShRNA-mediated silencing of Asns and Kras in a mouse Kras;p16p19 RMS 633 cell line reduced proliferation activity compared to shLUC-infected control cells as 634 measured by MTT uptake. Asparagine supplementation (100mg/L) in the tissue 635 culture medium reversed the anti-proliferative effects of shASNS but not shKRAS. 636 (C-F) Asns silencing increased the (C-D) percentage of apoptotoc (PI637 /Annexin5+) cells and reduced the (E-F) percentage of S phase cells as 638 determined by BrdU staining, compared to shLUC-infected control cells. Both 639 effects were reversed by exogenous Asparagine supplementation (100mg/L). (G) 640 Polypeptide synthetic activity was determined by OP-puromycin staining. Absent 641 OP-puromycin staining in cells treated with cycloheximide (right panels), an 642 inhibitor of protein translation, validated the experimental approach. Asns 643 silencing reduced polypeptide synthesis in Kras;p16p19 RMS cells (top left 644 panel), and polypeptide synthesis was restored in shASNS RMS cells by 645 Asparagine supplementation (bottom left panel). (A-F) Data were evaluated for 646 statistical significance by T-tests (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001). 647 See Figure 2 – figure supplement 1 for similar effects of Asns silencing in mouse 648 Kras;p16p19 NMS cells. 649 650 Figure 3. Reduced growth of human Rh30 RMS cells after ASNS 651 silencing is associated with reduced polypeptide synthesis. (A) ShRNA652 mediated silencing of ASNS in Rh30 cells was validated by Western Blot. (B-C) 653 ASNS silencing reduced proliferation compared to shLACZ-infected control cells 654 as measured by MTT uptake. Asparagine supplementation (100mg/L) in the 655 tissue culture medium reversed the anti-proliferative effects of shASNS. (D-G) 656 ASNS silencing increased the (D-E) percentage of apoptotic (PI-/Annexin5+) 657 cells and reduced the (F-G) percentage of S-phase cells (F,G), as compared to 658 shLACZ-infected control cells. (F-G) Exogenous Asparagine supplementation 659 reversed shASNS effects on cell cycle progression. (H) Polypeptide synthetic 660 activity was determined by OP-puromycin staining. Absent OP-puromycin 661 staining in Rh30 cells treated with cycloheximide (right panels) validated the 662 experimental approach. ASNS silencing reduced polypeptide synthesis (top left 663 panel), and polypeptide synthesis was restored in shASNS RMS cells by 664 Asparagine supplementation (bottom left panel). (B-G) Data were evaluated for 665 statistical significance by T-tests (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001). 666 667 Figure 4. Inhibition of mouse and human sarcoma cell growth in vitro by 668 chemical compounds interfering with Asparagine homeostasis. (A-C) 669 Proliferation assays of mouse (Ms RMS, Ms NMS) and human (HT1080, RD, 670 Rh41, Rh30) sarcoma cell lines exposed to the indicated doses of chemical 671 modulators of Asparagine homeostasis: (A-B) Asparaginase or (A, C) AS5. Both 672 chemicals were diluted in 0.9% NaCl (Normal Saline (NS)) as vehicle. (D) 673 Chemical and genetic ASNS inhibition was reversed by exogenous 674 supplementation with 100mg/L asparagine in the tissue culture medium (100 675 mg/L, which corresponds to 757μM; compared to normal asparagine 676 concentrations in mouse and human plasma of 29μM and 55μM, respectively 677 (Cooney et al., 1970)). Data were evaluated for statistical significance by T-tests 678 (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001). See Figure 4 – figure supplement 679 1 for ASNS expression in human sarcoma cells. 680 681 Figure 5. Asns silencing delayed Kras;p16p19null RMS growth in 682 Asparagine-depleted mice. (A) Tumors arising from shASNS RMS cells 683 expressed less ASNS than tumors arising from shLUC cells as shown by IHC 684 staining. Of 6 tumors arising from shASNS cells, cytoplasmic ASNS positivity 685 was observed in 50-75% of cells in one tumor, in 25-50% of cells in 3 tumors and 686 in <25% of cells in 2 tumors. Of 5 tumors arising from control shLUC-cells, 687 cytoplasmic ASNS staining was detected in >75% of cells in 3 tumors and in 25688 50% of cells in 2 tumors. Representative images are shown. (B) Effects of Asns 689 silencing on tumor growth in vivo were evaluated by transplantation. One 690 subgroup of recipient mice was treated with Asparaginase (Elspar) by daily 691 intraperitoneal (IP) injections at a dose of 1500IU/kg. ShASNS silencing delayed 692 tumor onset in recipient mice treated with Asparaginase compared to shLUC693 infected RMS cells (p<0.0001). (C) Asparaginase-treated mice maintained their 694 weight over the course of a 19-day exposure. Each experimental group 695 included 5 mice, and findings were replicated in 2 independent 696 transplantation experiments. (D) Daily IP injection of Asparaginase results in a 697 13-fold reduction in serum Asparagine levels from 52±7 to 4±1 μmol/L. 698 Differences in tumor latency were evaluated for statistical significance by 699 logrank (Mantel-Cox) test. Differences in serum amino acid concentrations 700 were determined by T-test (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001). See 701 Figure 5 – figure supplement 1 for similar effects of Asns silencing in 702 Kras;p16p19 NMS cells on secondary tumor induction and Supplementary File 703 7 for changes in serum amino acid levels in Asparaginase-treated versus control 704 mice. 705 706 Supplement Figure and File Legends 707 708 Supplement Figures 709 710 Figure 1 – figure supplement 1. Sarcoma induction strategy. Muscle 711 satellite cells and fibroadipogenic precursor cells were isolated by FACS 712 according to the indicated cell surface markers from mouse skeletal 713 muscle freshly dissected from Cdkn2a-/(p16p19null) mice. Freshly sorted 714 cells were transduced with oncogenic Kras using a Kras(G12v)-IRES-GFP 715 lentivirus, and transduced cells were implanted into the cardiotoxin pre716 injured extremity muscles of NOD.SCID mice by intramuscular (i.m.) 717 injection within 36-48 hours from cell isolation. The myogenic 718 differentiation status of the resulting Ras-driven sarcomas generated in 719 this system was largely dependent on the cell type transduced: satellite 720 cells typically gave rise to rhabdomyosarcoma (RMS; MyoD+, Myogenin+), 721 whereas the identical oncogenetic lesions introduced into fibroadipogenic 722 precursors within the MFA cell pool almost always produced sarcomas 723 lacking myogenic differentiation features (MyoD-, Myogenin-; non724 myogenic sarcomas, NMS) (Hettmer et al., 2011). 725 726 Figure 2 – figure supplement 1. Reduced mouse Kras;p16p19null NMS 727 cell growth after Asns silencing was associated with reduced polypeptide 728 synthesis. (A-B) ShRNA-mediated silencing of Asns and Kras in a mouse 729 Kras;p16p19 NMS cell line reduced proliferation activity compared to shLUC730 infected control cells as measured by MTT uptake. Asparagine supplementation 731 (100mg/L) in the tissue culture medium reversed the anti-proliferative effects of 732 shASNS, but not shKRAS. (C-D) Asns silencing did not change the percentage 733 of PI-/Annexin5+ apoptotic cells. (E-F) Asns silencing reduced the percentage of 734 cells in S phase as determined by BrdU staining, compared to shLUC-infected 735 control cells. This effect was reversed by exogenous Asparagine 736 supplementation. (G) Polypeptide synthetic activity was determined by OP737 puromycin staining. Absent OP-puromycin staining in cells treated with 738 cycloheximide (right panels) validated the experimental approach. Asns silencing 739 reduced polypeptide synthesis in Kras;p16p19 NMS cells (top left panel), and 740 polypeptide synthesis was restored in shASNS RMS cells by Asparagine 741 supplementation (bottom left panel) (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; 742 as determined by T-tests). 743 744 Figure 2 figure supplement 2. Asparagine concentrations of 10 or 745 100mg/L reverse the effects of ASNS silencing on sarcoma growth. 746 Kras;p16p19null RMS and NMS cells were transduced with shASNSand 747 shLUC-lentivirus. Transduced cells were cultured in the presence of 748 increasing concentrations of asparagine (0.01 – 100mg/L). Asparagine at 10 749 or 100mg/L reversed the growth-inhibitory effects of ASNS silencing on 750 Kras;p16p19null RMS (A) and NMS cells (B; ns p≥0.05, * p<0.05, ** p<0.01, *** 751 p <0.001; as determined by T-tests). 752 753 Figure 2 – figure supplement 3. Glutaminase expression in mouse 754 Kras;p16p19null sarcoma cells. Mouse Kras;p16p19null RMS and NMS cells 755 express 7to 11-fold higher Glutaminase levels compared to mouse 756 skeletal muscle (SM; ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as 757 determined by T-tests compared to normal muscle sample SM1). 758 759 Figure 4 – figure supplement 1. Expression of candidate sarcoma 760 targets in human sarcoma tissue. (A-B) Immunohistochemical (IHC) staining of 761 commercially available sarcoma tissue arrays (US Biomax SO2081) detected 762 ASNS expression in (A) 73% of human RMS cores (22 tumors evaluated) and in 763 (B) 44% of human leiomyosarcoma (LMS) cores (27 tumors evaluated). 764 Representative stains are shown. (C) ASNS expression was detected in human 765 sarcoma cell lines by qRT-PCR (ns p≥0.05, * p<0.05, ** p<0.01, *** p <0.001; as 766 determined by T-tests compared to target gene expression in adult muscle). 767 768 Figure 5 – figure supplement 1. Asns silencing delayed Kras;p16p19null 769 NMS growth in Asparagine-depleted mice. Mouse Kras;p16p19 NMS cells 770 were transplanted into 1to 3-months old NOD.SCID recipient mice. (A) Tumors 771 arising from shASNS NMS cells expressed less ASNS than tumors arising from 772 shLUC cells as shown by IHC staining. (B) Effects of Asns silencing on tumor 773 growth in vivo were evaluated by transplantation. One subgroup of recipient mice 774 was treated with Asparaginase (Elspar) by daily intraperitoneal (IP) injections at a 775 dose of 1500IU/kg. ShASNS silencing delayed tumor onset in recipient mice 776 treated with asparaginase compared to shLUC-infected NMS cells (p=0.005). 777 Transplantation of shASNS cells into recipients that were not exposed to 778 asparaginase, or transplantation of shLUC cells into asparaginase-treated 779 recipients did not delay tumor onset. Each experimental group included 5 780 mice, and findings were replicated in 2 independent transplantation 781 experiments. Differences in tumor latency were evaluated for statistical 782 significance by logrank (Mantel-Cox) test. 783 784 Supplementary Files 785 786 Supplementary File 1. Kras; p16p19 RMS cell line T14R: raw data from 787 shRNA screen (plates DAS36-DAS45). 788 789 Supplementary File 2. Kras; p16p19 NMS cell line Sca1-01: raw data from 790 shRNA screen (plates DAS36-DAS45). 791 792 Supplementary File 3. Kras; p16p19 RMS cell line T14R: raw data from 793 shRNA screen (control plate CTR01). 794 795 Supplementary File 4. Kras; p16p19 NMS cell line Sca1-01: raw data from 796 shRNA screen (control plate CTR01). 797 798 Supplementary File 5. Kras; p16p19 RMS cell line T14R: statistical evaluation 799 (Significance levels: 1, 5 shRNAs with FDR<30%; 2, 4 shRNAs with FDR<30%; 3, 800 3 shRNAs with FDR<30%). 801 802 Supplementary File 6. Kras; p16p19 NMS cell line Sca1-01: statistical803evaluation (Significance levels: 1, 5 shRNAs with FDR<30%; 2, 4 shRNAs with804FDR<30%; 3, 3 shRNAs with FDR<30%).805806Supplementary File 7. Amino acid levels (μM) in Asparaginase-treated and807 untreated mice.808809References810BALASUBRAMANIAN, M. N., BUTTERWORTH, E. A. & KILBERG, M. S. 2013.811Asparagine synthetase: regulation by cell stress and involvement in tumor812biology. Am J Physiol Endocrinol Metab, 304, E789-99.813BOVEE, J. V. & HOGENDOORN, P. C. 2010. Molecular pathology of sarcomas:814concepts and clinical implications. Virchows Arch, 456, 193-9.815CHEN, X., STEWART, E., SHELAT, A. A., QU, C., BAHRAMI, A., HATLEY, M.,816WU, G., BRADLEY, C., MCEVOY, J., PAPPO, A., SPUNT, S.,817VALENTINE, M. B., VALENTINE, V., KRAFCIK, F., LANG, W. H.,818 WIERDL, M., TSURKAN, L., TOLLEMAN, V., FEDERICO, S. M.,819MORTON, C., LU, C., DING, L., EASTON, J., RUSCH, M.,820NAGAHAWATTE, P., WANG, J., PARKER, M., WEI, L., HEDLUND, E.,821 FINKELSTEIN, D., EDMONSON, M., SHURTLEFF, S., BOGGS, K.,822 MULDER, H., YERGEAU, D., SKAPEK, S., HAWKINS, D. S., RAMIREZ,823N., POTTER, P. M., SANDOVAL, J. A., DAVIDOFF, A. M., MARDIS, E. R.,824WILSON, R. K., ZHANG, J., DOWNING, J. R. & DYER, M. A. 2013.825 Targeting oxidative stress in embryonal rhabdomyosarcoma. Cancer Cell,82624, 710-24.827COONEY, D. A., CAPIZZI, R. L. & HANDSCHUMACHER, R. E. 1970. Evaluation828of L-asparagine metabolism in animals and man. Cancer Res, 30, 929-35.829CUI, H., DARMANIN, S., NATSUISAKA, M., KONDO, T., ASAKA, M., SHINDOH,830M., HIGASHINO, F., HAMURO, J., OKADA, F., KOBAYASHI, M.,831NAKAGAWA, K. & KOIDE, H. 2007. Enhanced expression of asparagine832synthetase under glucose-deprived conditions protects pancreatic cancer833cells from apoptosis induced by glucose deprivation and cisplatin. Cancer834Res, 67, 3345-55.835FINE, B. M., KASPERS, G. J., HO, M., LOONEN, A. H. & BOXER, L. M. 2005. A836genome-wide view of the in vitro response to l-asparaginase in acute837lymphoblastic leukemia. Cancer Res, 65, 291-9.838HASKELL, C. M., CANELLOS, G. P., LEVENTHAL, B. G., CARBONE, P. P.,839BLOCK, J. B., SERPICK, A. A. & SELAWRY, O. S. 1969. L-asparaginase:840therapeutic and toxic effects in patients with neoplastic disease. N Engl J841Med, 281, 1028-34.842HETTMER, S., LIU, J., MILLER, C. M., LINDSAY, M. C., SPARKS, C. A.,843GUERTIN, D. A., BRONSON, R. T., LANGENAU, D. M. & WAGERS, A. J.844 2011. Sarcomas induced in discrete subsets of prospectively isolated845skeletal muscle cells. Proc Natl Acad Sci U S A, 108, 20002-7.846 HUANG, F., ZHANG, Q., MA, H., LV, Q. & ZHANG, T. 2014. Expression of847glutaminase is upregulated in colorectal cancer and of clinical significance.848Int J Clin Exp Pathol, 7, 1093-100.849IKEUCHI, H., AHN, Y. M., OTOKAWA, T., WATANABE, B., HEGAZY, L.,850HIRATAKE, J. & RICHARDS, N. G. 2012. A sulfoximine-based inhibitor of851human asparagine synthetase kills L-asparaginase-resistant leukemia852cells. Bioorg Med Chem, 20, 5915-27.853JAFFE, N., TRAGGIS, D., DAS, L., MOLONEY, W. C., HANN, H. W., KIM, B. S.854& NAIR, R. 1971. L-asparaginase in the treatment of neoplastic diseases855in children. Cancer Res, 31, 942-9.856JAIN, M., NILSSON, R., SHARMA, S., MADHUSUDHAN, N., KITAMI, T.,857SOUZA, A. L., KAFRI, R., KIRSCHNER, M. W., CLISH, C. B. & MOOTHA,858V. K. 2012. Metabolite profiling identifies a key role for glycine in rapid859cancer cell proliferation. Science, 336, 1040-4.860JEWELL, J. L., KIM, Y. C., RUSSELL, R. C., YU, F. X., PARK, H. W., PLOUFFE,861S. W., TAGLIABRACCI, V. S. & GUAN, K. L. 2015. Metabolism.862Differential regulation of mTORC1 by leucine and glutamine. Science, 347,863194-8.864LABUSCHAGNE, C. F., VAN DEN BROEK, N. J., MACKAY, G. M., VOUSDEN,865 K. H. & MADDOCKS, O. D. 2014. Serine, but not glycine, supports one-866carbon metabolism and proliferation of cancer cells. Cell Rep, 7, 1248-58.867LI, H., ZHOU, F., DU, W., DOU, J., XU, Y., GAO, W., CHEN, G., ZUO, X., SUN,868L., ZHANG, X. & YANG, S. 2015. Knockdown of asparagine synthetase by869 RNAi suppresses cell growth in human melanoma cells and epidermoid870carcinoma cells. Biotechnol Appl Biochem.871LINCH, M., MIAH, A. B., THWAY, K., JUDSON, I. R. & BENSON, C. 2014.872Systemic treatment of soft-tissue sarcoma-gold standard and novel873therapies. Nat Rev Clin Oncol, 11, 187-202.874LIU, J., XU, Y., STOLERU, D. & SALIC, A. 2012. Imaging protein synthesis in875cells and tissues with an alkyne analog of puromycin. Proc Natl Acad Sci876U S A, 109, 413-8.877LOCASALE, J. W., GRASSIAN, A. R., MELMAN, T., LYSSIOTIS, C. A.,878MATTAINI, K. R., BASS, A. J., HEFFRON, G., METALLO, C. M.,879MURANEN, T., SHARFI, H., SASAKI, A. T., ANASTASIOU, D.,880MULLARKY, E., VOKES, N. I., SASAKI, M., BEROUKHIM, R.,881STEPHANOPOULOS, G., LIGON, A. H., MEYERSON, M., RICHARDSON,882A. L., CHIN, L., WAGNER, G., ASARA, J. M., BRUGGE, J. S., CANTLEY,883L. C. & VANDER HEIDEN, M. G. 2011. Phosphoglycerate dehydrogenase884diverts glycolytic flux and contributes to oncogenesis. Nat Genet, 43, 869-885 74.886MCNICOL, J. W. 2013. Significance testing after analysis of variance. . Annals of887Applied Biology, 162, 288-9.888 PANDURANGAN, S., PAJAK, A., MOLNAR, S. J., COBER, E. R.,889 DHAUBHADEL, S., HERNANDEZ-SEBASTIA, C., KAISER, W. M.,890NELSON, R. L., HUBER, S. C. & MARSOLAIS, F. 2012. Relationship891 between asparagine metabolism and protein concentration in soybean892seed. J Exp Bot, 63, 3173-84.893PARHAM, D. M. & BARR, F. G. 2013. Classification of rhabdomyosarcoma and894its molecular basis. Adv Anat Pathol, 20, 387-97.895POSSEMATO, R., MARKS, K. M., SHAUL, Y. D., PACOLD, M. E., KIM, D.,896BIRSOY, K., SETHUMADHAVAN, S., WOO, H. K., JANG, H. G., JHA, A.897K., CHEN, W. W., BARRETT, F. G., STRANSKY, N., TSUN, Z. Y.,898COWLEY, G. S., BARRETINA, J., KALAANY, N. Y., HSU, P. P., OTTINA,899K., CHAN, A. M., YUAN, B., GARRAWAY, L. A., ROOT, D. E., MINO-900KENUDSON, M., BRACHTEL, E. F., DRIGGERS, E. M. & SABATINI, D.901M. 2011. Functional genomics reveal that the serine synthesis pathway is902essential in breast cancer. Nature, 476, 346-50.903RICHARDS, N. G. & KILBERG, M. S. 2006. Asparagine synthetase904chemotherapy. Annu Rev Biochem, 75, 629-54.905SCIAN, M. J., STAGLIANO, K. E., DEB, D., ELLIS, M. A., CARCHMAN, E. H.,906DAS, A., VALERIE, K., DEB, S. P. & DEB, S. 2004. Tumor-derived p53907 mutants induce oncogenesis by transactivating growth-promoting genes.908Oncogene, 23, 4430-43.909SHERN, J. F., CHEN, L., CHMIELECKI, J., WEI, J. S., PATIDAR, R.,910 ROSENBERG, M., AMBROGIO, L., AUCLAIR, D., WANG, J., SONG, Y.911 K., TOLMAN, C., HURD, L., LIAO, H., ZHANG, S., BOGEN, D., BROHL, A.912S., SINDIRI, S., CATCHPOOLE, D., BADGETT, T., GETZ, G., MORA, J.,913ANDERSON, J. R., SKAPEK, S. X., BARR, F. G., MEYERSON, M.,914 HAWKINS, D. S. & KHAN, J. 2014. Comprehensive genomic analysis of915rhabdomyosarcoma reveals a landscape of alterations affecting a916common genetic axis in fusion-positive and fusion-negative tumors.917Cancer Discov, 4, 216-31.918SON, J., LYSSIOTIS, C. A., YING, H., WANG, X., HUA, S., LIGORIO, M.,919PERERA, R. M., FERRONE, C. R., MULLARKY, E., SHYH-CHANG, N.,920KANG, Y., FLEMING, J. B., BARDEESY, N., ASARA, J. M., HAIGIS, M.921C., DEPINHO, R. A., CANTLEY, L. C. & KIMMELMAN, A. C. 2013.922Glutamine supports pancreatic cancer growth through a KRAS-regulated923metabolic pathway. Nature, 496, 101-5.924SOOD, R., PORTER, A. C., OLSEN, D. A., CAVENER, D. R. & WEK, R. C. 2000.925A mammalian homologue of GCN2 protein kinase important for926translational control by phosphorylation of eukaryotic initiation factor-9272alpha. Genetics, 154, 787-801.928SZYMANSKA, B., WILCZYNSKA-KALAK, U., KANG, M. H., LIEM, N. L., CAROL,929H., BOEHM, I., GROEPPER, D., REYNOLDS, C. P., STEWART, C. F. &930 LOCK, R. B. 2012. Pharmacokinetic modeling of an induction regimen for931in vivo combined testing of novel drugs against pediatric acute932lymphoblastic leukemia xenografts. PLoS One, 7, e33894.933 TARDITO, S., BUSSOLATI, O., GACCIOLI, F., GATTI, R., GUIZZARDI, S.,934 UGGERI, J., MARCHIO, L., LANFRANCHI, M. & FRANCHI-GAZZOLA, R.9352006. Non-apoptotic programmed cell death induced by a copper(II)936complex in human fibrosarcoma cells. Histochem Cell Biol, 126, 473-82.937 ZHANG, J., FAN, J., VENNETI, S., CROSS, J. R., TAKAGI, T., BHINDER, B.,938DJABALLAH, H., KANAI, M., CHENG, E. H., JUDKINS, A. R., PAWEL, B.,939BAGGS, J., CHERRY, S., RABINOWITZ, J. D. & THOMPSON, C. B. 2014.940Asparagine plays a critical role in regulating cellular adaptation to941glutamine depletion. Mol Cell, 56, 205-18.942943944